Genetic Engineering is the study of an organisms genome using DNA technology. It is a specialized field requiring the work of experts. You can use the services offered by our website to get specialized help related with genetic engineering work. Start by posting your project on our website. Найняти Genetic Engineering Professionals

Фільтрувати

Мої недавні пошуки
Фільтрувати по:
Бюджет
до
до
до
Тип
Навички
Мови
    Статус роботи
    1 робіт знайдено, ціни вказані в USD
    Genomics Variants Exploration -- 2 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $5 / hr (Avg Bid)
    $5 / hr Сер. заявка
    5 заявки