Мова програмування R Jobs

R is an open source programming language for statistical computing and graphics, it is widely used by statisticians and data miners.

Найняти R Programmers

Фільтрувати

Мої недавні пошуки
Фільтрувати по:
Бюджет
до
до
до
Тип
Навички
Мови
    Статус роботи
    77 робіт знайдено, ціни вказані в USD
    Website Data Optimisation 6 дні(-в) left

    Hey everyone, thank you for reviewing this job post: Our business is currently trying to grow its customer base through optimisation and we need to better analyse our website traffic and turnover rate. We have all the data extracted from our platform but we need an statistical analysis expert to be able to analyse these accordingly. Look forward to getting in touch

    $77 (Avg Bid)
    $77 Сер. заявка
    2 заявки
    Website Data Optimization 6 дні(-в) left

    Hey everyone, thank you for reviewing this job post: Our business is currently trying to grow its customer base through optimization and we need to better analyse our website traffic and turnover rate. We have all the data extracted from our platform but we need an statistical analysis expert to be able to analyse these accordingly. Look forward to getting in touch

    $29 (Avg Bid)
    $29 Сер. заявка
    1 заявки
    I need a programmer 6 дні(-в) left

    I want to write a code for a variational autoencoder (with time series data) and I don't know where to start. It is for my thesis so very important. The data consists of multiple timepoints and a lot of different variables per timestep, i dont know how to impute these timepoints. Should I impute them all in once or per timestep > what kind of preprocessing steps should i do > etc.

    $149 (Avg Bid)
    $149 Сер. заявка
    11 заявки

    I'm looking for a freelance to support the new ML division lunch or to join the company. The concept is to use out-of-the-box tools and pre-trained models as much as possible and to create a scalable solution to be delivered to our >400 clients around the world (Luftansa, Swiss, Fiat, MobileEye, Playtica, IronSource...).

    min $50 / hr
    min $50 / hr
    0 заявки
    Application Development on R 6 дні(-в) left
    ПІДТВЕРДЖЕНО

    Create applications in R Implement vulnerabilities in these applications. Develop secure and insecure solutions for the vulnerable code Create training modules based on the developed code.

    $255 (Avg Bid)
    $255 Сер. заявка
    4 заявки

    I need to run my R code from a website, basically, on some user submission the code executed and the return response to be displayed back on the website

    $6 / hr (Avg Bid)
    $6 / hr Сер. заявка
    2 заявки

    Looking for someone to come in, link R shiny to our web host server! We have developed RShiny apps, and now want to create a website. If you have created a website using R Shiny you are the perfect person for this job! Thank you!

    $160 (Avg Bid)
    $160 Сер. заявка
    3 заявки

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $108 (Avg Bid)
    $108 Сер. заявка
    26 заявки
    I need an R programmer 6 дні(-в) left

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $183 (Avg Bid)
    $183 Сер. заявка
    28 заявки
    Genomics Variants Exploration -- 2 5 дні(-в) left
    ПІДТВЕРДЖЕНО

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $6 / hr (Avg Bid)
    $6 / hr Сер. заявка
    3 заявки

    Lets discuss more detail via zoom It may help to know that the project is to reproduce one of the tabs depicted here: [увійдіть, щоб побачити URL]

    $37 (Avg Bid)
    $37 Сер. заявка
    4 заявки
    Looking for R shiny expert 5 дні(-в) left

    are you know Rshiny well? Lets discuss more detail via zoom

    $15 (Avg Bid)
    $15 Сер. заявка
    1 заявки
    $27 Сер. заявка
    5 заявки
    Looking for Rshiny expert 5 дні(-в) left

    I have the code for the graph itself completed, but need help with the RShiny component of the work (reactives, etc.).

    $10 - $30
    $10 - $30
    0 заявки
    SAS Programming 5 дні(-в) left

    Looking for a SAS programmer to work on my Project

    $1107 (Avg Bid)
    $1107 Сер. заявка
    6 заявки

    Looking for SAS programmer to guide in my new project

    $1229 (Avg Bid)
    $1229 Сер. заявка
    6 заявки
    I need a SAS Programmer 5 дні(-в) left

    Looking for a SAS programmer who can guide me in my project

    $1181 (Avg Bid)
    $1181 Сер. заявка
    4 заявки
    Thesis Paper -- 2 5 дні(-в) left
    ПІДТВЕРДЖЕНО

    Writing a thesis paper, extracting datas and know a statistical software ( Stata or R).

    $83 (Avg Bid)
    $83 Сер. заявка
    32 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $117 (Avg Bid)
    $117 Сер. заявка
    11 заявки
    Build a R studio program. 5 дні(-в) left
    ПІДТВЕРДЖЕНО

    The project deals with cryptocurrencies. We have to download data for at least 10 cryptos and to find the efficient portfolio in MV, following Markowitz. Sufficient constraints must also be included. We have to draw the efficient frontier, compute the weigths of the optimal portfolio, generate the price series of the portfolio retroactively and plot the portfolio series. We also have to do this in...

    $150 (Avg Bid)
    $150 Сер. заявка
    5 заявки
    Execute a R script into my server 5 дні(-в) left
    ПІДТВЕРДЖЕНО

    Hello, I have installed R into my server and I want to execute an R script into it using PHP language, The R script does this job: 1. Read three files (type of CSV ) that come from a HTML form. 2. Return a file in CSV. The R script is already runnable and functional. I want just to execute this script on my server and return the CSV file back.

    $25 (Avg Bid)
    $25 Сер. заявка
    3 заявки
    R programming expert 4 дні(-в) left

    I need to learn how to match data using R CEM package based on several variables. I have a sample set of scientific data with several variables (Treatment vs non-treatment group). I would like to know who to identify matches using R coarsened exact matching (CEM). Identying matching cases using CEM in R studio I would like to match people who received TXA (n=15) in this small sample with the rema...

    $31 (Avg Bid)
    $31 Сер. заявка
    5 заявки
    R, Stata, Excel 4 дні(-в) left
    ПІДТВЕРДЖЕНО

    I need help with constructing a data base using a combination of R, and Stata and Excel URGENTLY

    $21 / hr (Avg Bid)
    $21 / hr Сер. заявка
    22 заявки

    Hi, I am looking for an expert to help in completing my research methodology and interpretation on the topic "Stock Price Movement around the Merger and Acquisition Announcements – An Event Study". Please bid your best price and timeline for completion of work. Thanks

    $112 (Avg Bid)
    $112 Сер. заявка
    6 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $153 (Avg Bid)
    $153 Сер. заявка
    18 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $133 (Avg Bid)
    $133 Сер. заявка
    17 заявки
    R programming urgent 4 дні(-в) left

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $151 (Avg Bid)
    $151 Сер. заявка
    13 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $139 (Avg Bid)
    $139 Сер. заявка
    12 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbox

    $140 (Avg Bid)
    $140 Сер. заявка
    7 заявки

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $146 (Avg Bid)
    $146 Сер. заявка
    11 заявки
    data science r programming 4 дні(-в) left

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $152 (Avg Bid)
    $152 Сер. заявка
    22 заявки
    Data Science Questions in R -- 2 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

    $377 (Avg Bid)
    $377 Сер. заявка
    13 заявки
    Need machine learning and python expert 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    We are hiring freelancers for part-time and full time role for our organization... Interested candidate having a good knowledge in python and machine learning should only bid here.. Good Knowledge of R language is a plus

    $104 (Avg Bid)
    $104 Сер. заявка
    18 заявки
    Working on R STudio 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    i am looking for help on R studio task i will share complete details on the chat

    $33 (Avg Bid)
    $33 Сер. заявка
    12 заявки

    I have a machine learning report which needs to be modified to reduce plagiarism. I need it urgently.

    $3 / hr (Avg Bid)
    $3 / hr Сер. заявка
    4 заявки
    Need to Build a trading journal for data analysis 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    I am looking for a professional with excellent mathematics skills to build a trading journal for data analysis. In a website form were customers will access on a subscription base account

    $22 / hr (Avg Bid)
    $22 / hr Сер. заявка
    13 заявки
    SAS Project Assistance -- 3 3 дні(-в) left
    ПІДТВЕРДЖЕНО

    We are from an IT consulting firm and an online tutoring company One of our client is in need of SAS Project Assistance which has to be completed in 2 to 3 days - on or before 10th April IST So only if you are available in these 2 days to do this kindly bid this project

    $4 / hr (Avg Bid)
    $4 / hr Сер. заявка
    1 заявки
    Need help with simulation in R 2 дні(-в) left
    ПІДТВЕРДЖЕНО

    Simulation of distributions Stochastic simulation Acceptance Rejection Method

    $23 (Avg Bid)
    $23 Сер. заявка
    3 заявки
    Data Science within R 2 дні(-в) left
    ПІДТВЕРДЖЕНО

    I have some work that is files. Those of you who have skills on this job can bid for this project. I will select one of you and give him all the work. It is a very easy task and give me suggestion. I will share all details within only selected person.

    $10 - $30
    Прихований
    $10 - $30
    28 заявки
    Data Science Questions in R 2 дні(-в) left
    ПІДТВЕРДЖЕНО

    I need someone to answer 3 data science related multi part questions which requires R programming. Please DM for more information. Need it in 2-3 days. The faster the better. Questions come with guidelines. Rates negotiable.

    $294 (Avg Bid)
    $294 Сер. заявка
    9 заявки
    R language expert 2 дні(-в) left

    Assalma-o-Alaikum greetings I need R coding and Data Analysis

    $16 (Avg Bid)
    $16 Сер. заявка
    5 заявки
    Looking for a R Programmer 2 дні(-в) left

    I'm looking for some R programming help. I have a little project and I'm stuck in a process due to my limited knowledge. This is an Inventory Management project. I've created a script: Materials in Location A (6 Stocks) are moved to Location B (5 Stocks), based on some constraints (transport tonnage capacity and material grade control). It's a LP model. I would like to: 1. Inco...

    $105 (Avg Bid)
    $105 Сер. заявка
    12 заявки
    Compare test scores of that my classes scored. 2 дні(-в) left
    ПІДТВЕРДЖЕНО

    A) Summarize what the data set is ( I will send scores from 4 exams) B) Identify a problem in which a statistical test could be used and why it is important to analyze this Here are some examples of problems: Is the average score of all exams greater than 70? We want to compare performance on exams of online vs in person students We want to compare the difficulty of Exam 1 vs Exam 4. We want to...

    $102 (Avg Bid)
    $102 Сер. заявка
    9 заявки

    I would like you to generate a code where one can put all the needed information in the preamble of the code (notably the instruments, the time period, the source, etc) and generate an automatic one-page PDF report for each instrument in the list with the best performance measures and charts. It deals with performance analysis. Your code needs to deal with the size of the instruments' vector ...

    $20 (Avg Bid)
    $20 Сер. заявка
    3 заявки

    Your solutions should contain all relevant R outputs needed to justify your answers/arguments, together with appropriate discussion. Please do not include codes/plots/output which you do not discuss. You are recommended to use R Markdown to produce your solutions, if you do not wish to included codes/outputs that you do not discuss, you can suppress the codes/outputs using the echo = FALSE argumen...

    $50 (Avg Bid)
    $50 Сер. заявка
    11 заявки
    [R] Statistical Analysis in Medical Data 1 день left
    ПІДТВЕРДЖЕНО

    Hello everyone, I will need an expert in Statistics that can do a medical interpretation on the results. I will send you the data and requirements Best

    $120 (Avg Bid)
    $120 Сер. заявка
    25 заявки
    Teach me ARFIMA 1 день left

    This is a requirement for a one time coaching session. I need to learn how to analyse data using ARFIMA in R Studio i.e. I need to learn the different commands to be executed, etc to get the required output. I believe that this can be done in a single session. Kindly quote a fixed price for this session. Also, to showcase your proficiency in this area, it would be great if you could forward sampl...

    $8 - $20
    $8 - $20
    0 заявки